predesigned atgl small interfering rna sirna Search Results


predesigned alt r crispr cas9 guide rna  (Danaher Inc)
86
Danaher Inc predesigned alt r crispr cas9 guide rna
Predesigned Alt R Crispr Cas9 Guide Rna, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/predesigned alt r crispr cas9 guide rna/product/Danaher Inc
Average 86 stars, based on 1 article reviews
predesigned alt r crispr cas9 guide rna - by Bioz Stars, 2026-02
86/100 stars
  Buy from Supplier
predesigned gsk 3 β sirna  (Santa Cruz Biotechnology)
93
Santa Cruz Biotechnology predesigned gsk 3 β sirna
Predesigned Gsk 3 β Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/predesigned gsk 3 β sirna/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
predesigned gsk 3 β sirna - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier
human predesigned targeted short hairpin rna (shrna) recombinant virus against ptk7  (Vigene Biosciences)
90
Vigene Biosciences human predesigned targeted short hairpin rna (shrna) recombinant virus against ptk7
Overexpressed <t>PTK7</t> expression connected with poor prognosis. (a) Low and high PTK7 protein expressions in the tumor tissues by IHC were shown. (b) The negative PTK7 protein expression in the paired tumor-adjacent tissues by IHC. (c) The overall survival and progression-free survival in our clinical cohort: the high PTK7 protein expression level group was significantly associated with shorter progression-free survival compared to the low expression group ( ∗ P < 0.05, respectively).
Human Predesigned Targeted Short Hairpin Rna (Shrna) Recombinant Virus Against Ptk7, supplied by Vigene Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human predesigned targeted short hairpin rna (shrna) recombinant virus against ptk7/product/Vigene Biosciences
Average 90 stars, based on 1 article reviews
human predesigned targeted short hairpin rna (shrna) recombinant virus against ptk7 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
silencer select predesigned sirna targeting ucp3  (Thermo Fisher)
86
Thermo Fisher silencer select predesigned sirna targeting ucp3
Overexpressed <t>PTK7</t> expression connected with poor prognosis. (a) Low and high PTK7 protein expressions in the tumor tissues by IHC were shown. (b) The negative PTK7 protein expression in the paired tumor-adjacent tissues by IHC. (c) The overall survival and progression-free survival in our clinical cohort: the high PTK7 protein expression level group was significantly associated with shorter progression-free survival compared to the low expression group ( ∗ P < 0.05, respectively).
Silencer Select Predesigned Sirna Targeting Ucp3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/silencer select predesigned sirna targeting ucp3/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
silencer select predesigned sirna targeting ucp3 - by Bioz Stars, 2026-02
86/100 stars
  Buy from Supplier
lacz nontargeting control guide  (Millipore)
90
Millipore lacz nontargeting control guide
Overexpressed <t>PTK7</t> expression connected with poor prognosis. (a) Low and high PTK7 protein expressions in the tumor tissues by IHC were shown. (b) The negative PTK7 protein expression in the paired tumor-adjacent tissues by IHC. (c) The overall survival and progression-free survival in our clinical cohort: the high PTK7 protein expression level group was significantly associated with shorter progression-free survival compared to the low expression group ( ∗ P < 0.05, respectively).
Lacz Nontargeting Control Guide, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lacz nontargeting control guide/product/Millipore
Average 90 stars, based on 1 article reviews
lacz nontargeting control guide - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
mouse egfr silencer select predesigned sirna  (Thermo Fisher)
86
Thermo Fisher mouse egfr silencer select predesigned sirna
Overexpressed <t>PTK7</t> expression connected with poor prognosis. (a) Low and high PTK7 protein expressions in the tumor tissues by IHC were shown. (b) The negative PTK7 protein expression in the paired tumor-adjacent tissues by IHC. (c) The overall survival and progression-free survival in our clinical cohort: the high PTK7 protein expression level group was significantly associated with shorter progression-free survival compared to the low expression group ( ∗ P < 0.05, respectively).
Mouse Egfr Silencer Select Predesigned Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse egfr silencer select predesigned sirna/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
mouse egfr silencer select predesigned sirna - by Bioz Stars, 2026-02
86/100 stars
  Buy from Supplier
silencer select predesigned sirna s13741  (Thermo Fisher)
90
Thermo Fisher silencer select predesigned sirna s13741
Overexpressed <t>PTK7</t> expression connected with poor prognosis. (a) Low and high PTK7 protein expressions in the tumor tissues by IHC were shown. (b) The negative PTK7 protein expression in the paired tumor-adjacent tissues by IHC. (c) The overall survival and progression-free survival in our clinical cohort: the high PTK7 protein expression level group was significantly associated with shorter progression-free survival compared to the low expression group ( ∗ P < 0.05, respectively).
Silencer Select Predesigned Sirna S13741, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/silencer select predesigned sirna s13741/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
silencer select predesigned sirna s13741 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
silencer select predesigned sirna s14054  (Thermo Fisher)
90
Thermo Fisher silencer select predesigned sirna s14054
Overexpressed <t>PTK7</t> expression connected with poor prognosis. (a) Low and high PTK7 protein expressions in the tumor tissues by IHC were shown. (b) The negative PTK7 protein expression in the paired tumor-adjacent tissues by IHC. (c) The overall survival and progression-free survival in our clinical cohort: the high PTK7 protein expression level group was significantly associated with shorter progression-free survival compared to the low expression group ( ∗ P < 0.05, respectively).
Silencer Select Predesigned Sirna S14054, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/silencer select predesigned sirna s14054/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
silencer select predesigned sirna s14054 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
sirna targeting bat3  (Thermo Fisher)
90
Thermo Fisher sirna targeting bat3
Overexpressed <t>PTK7</t> expression connected with poor prognosis. (a) Low and high PTK7 protein expressions in the tumor tissues by IHC were shown. (b) The negative PTK7 protein expression in the paired tumor-adjacent tissues by IHC. (c) The overall survival and progression-free survival in our clinical cohort: the high PTK7 protein expression level group was significantly associated with shorter progression-free survival compared to the low expression group ( ∗ P < 0.05, respectively).
Sirna Targeting Bat3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna targeting bat3/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
sirna targeting bat3 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
predesigned sicontrol (scrambled sirna not known to degrade any rna)  (Santa Cruz Biotechnology)
90
Santa Cruz Biotechnology predesigned sicontrol (scrambled sirna not known to degrade any rna)
Tm4f4 disrupts actin organization and migration through a ROCK-independent Rho GTPase pathway. (A-I) F-actin localization and organization was analyzed by rhodamine phalloidin staining in NIH 3T3 fibroblast (A) and 293T fibroblast (B,C) cells expressing (arrows) or not expressing (arrowheads) Tm4sf4-FLAG, as well as in mPacL20 ductal epithelial cells transfected with control siRNA (D-F) or siTm4sf4 (G-I). Confocal magnification 63×. (J) Schematic depicting cytoskeletal actin structures (yellow) affected by Tm4sf4. (K) Percentage of mPacL20 cells exhibiting the phenotype displayed in G-I. (L,M) Nuclei positive cells migrated in Boyden chamber assays were compared in <t>siControl</t> (gray) and siTm4sf4 (black) transfected cells 16 hours after cells were treated with Rho family GTPase modulators. Error bars represent s.e.m. *P<0.05, **P<0.01.
Predesigned Sicontrol (Scrambled Sirna Not Known To Degrade Any Rna), supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/predesigned sicontrol (scrambled sirna not known to degrade any rna)/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
predesigned sicontrol (scrambled sirna not known to degrade any rna) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
sirna directed against human g9a  (Qiagen)
90
Qiagen sirna directed against human g9a
Tm4f4 disrupts actin organization and migration through a ROCK-independent Rho GTPase pathway. (A-I) F-actin localization and organization was analyzed by rhodamine phalloidin staining in NIH 3T3 fibroblast (A) and 293T fibroblast (B,C) cells expressing (arrows) or not expressing (arrowheads) Tm4sf4-FLAG, as well as in mPacL20 ductal epithelial cells transfected with control siRNA (D-F) or siTm4sf4 (G-I). Confocal magnification 63×. (J) Schematic depicting cytoskeletal actin structures (yellow) affected by Tm4sf4. (K) Percentage of mPacL20 cells exhibiting the phenotype displayed in G-I. (L,M) Nuclei positive cells migrated in Boyden chamber assays were compared in <t>siControl</t> (gray) and siTm4sf4 (black) transfected cells 16 hours after cells were treated with Rho family GTPase modulators. Error bars represent s.e.m. *P<0.05, **P<0.01.
Sirna Directed Against Human G9a, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna directed against human g9a/product/Qiagen
Average 90 stars, based on 1 article reviews
sirna directed against human g9a - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
suresilencing ™ predesigned shrna  (Qiagen)
90
Qiagen suresilencing ™ predesigned shrna
Tm4f4 disrupts actin organization and migration through a ROCK-independent Rho GTPase pathway. (A-I) F-actin localization and organization was analyzed by rhodamine phalloidin staining in NIH 3T3 fibroblast (A) and 293T fibroblast (B,C) cells expressing (arrows) or not expressing (arrowheads) Tm4sf4-FLAG, as well as in mPacL20 ductal epithelial cells transfected with control siRNA (D-F) or siTm4sf4 (G-I). Confocal magnification 63×. (J) Schematic depicting cytoskeletal actin structures (yellow) affected by Tm4sf4. (K) Percentage of mPacL20 cells exhibiting the phenotype displayed in G-I. (L,M) Nuclei positive cells migrated in Boyden chamber assays were compared in <t>siControl</t> (gray) and siTm4sf4 (black) transfected cells 16 hours after cells were treated with Rho family GTPase modulators. Error bars represent s.e.m. *P<0.05, **P<0.01.
Suresilencing ™ Predesigned Shrna, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/suresilencing ™ predesigned shrna/product/Qiagen
Average 90 stars, based on 1 article reviews
suresilencing ™ predesigned shrna - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


Overexpressed PTK7 expression connected with poor prognosis. (a) Low and high PTK7 protein expressions in the tumor tissues by IHC were shown. (b) The negative PTK7 protein expression in the paired tumor-adjacent tissues by IHC. (c) The overall survival and progression-free survival in our clinical cohort: the high PTK7 protein expression level group was significantly associated with shorter progression-free survival compared to the low expression group ( ∗ P < 0.05, respectively).

Journal: Disease Markers

Article Title: The Increased PTK7 Expression Is a Malignant Factor in Cervical Cancer

doi: 10.1155/2019/5380197

Figure Lengend Snippet: Overexpressed PTK7 expression connected with poor prognosis. (a) Low and high PTK7 protein expressions in the tumor tissues by IHC were shown. (b) The negative PTK7 protein expression in the paired tumor-adjacent tissues by IHC. (c) The overall survival and progression-free survival in our clinical cohort: the high PTK7 protein expression level group was significantly associated with shorter progression-free survival compared to the low expression group ( ∗ P < 0.05, respectively).

Article Snippet: Human predesigned targeted short hairpin RNA (shRNA) recombinant virus against PTK7 was purchased from Vigene (target sequence: AACATCAAATGGATTGAGGCAGG; Vigene Biosciences Inc.).

Techniques: Expressing

Relationships of PTK7 and clinicopathological characteristics in 85 patients with cervical cancer.

Journal: Disease Markers

Article Title: The Increased PTK7 Expression Is a Malignant Factor in Cervical Cancer

doi: 10.1155/2019/5380197

Figure Lengend Snippet: Relationships of PTK7 and clinicopathological characteristics in 85 patients with cervical cancer.

Article Snippet: Human predesigned targeted short hairpin RNA (shRNA) recombinant virus against PTK7 was purchased from Vigene (target sequence: AACATCAAATGGATTGAGGCAGG; Vigene Biosciences Inc.).

Techniques: Expressing

Establishing the stable knockdown of PTK7 cell lines: (a, b) qRT-PCR and Western blot assay. PTK7 mRNA and protein levels were significantly decreased compared to the control. ( ∗ P < 0.05).

Journal: Disease Markers

Article Title: The Increased PTK7 Expression Is a Malignant Factor in Cervical Cancer

doi: 10.1155/2019/5380197

Figure Lengend Snippet: Establishing the stable knockdown of PTK7 cell lines: (a, b) qRT-PCR and Western blot assay. PTK7 mRNA and protein levels were significantly decreased compared to the control. ( ∗ P < 0.05).

Article Snippet: Human predesigned targeted short hairpin RNA (shRNA) recombinant virus against PTK7 was purchased from Vigene (target sequence: AACATCAAATGGATTGAGGCAGG; Vigene Biosciences Inc.).

Techniques: Knockdown, Quantitative RT-PCR, Western Blot, Control

PTK7 regulated cell proliferation by Ki67 and PCNA proteins. (a) Colony formation assay. Results demonstrated that in Caski and SiHa cell lines, the control groups showed significantly higher survival fraction than the PTK7 knockdown groups ( ∗ P < 0.05). (b) MTT proliferation assay. OD values were showed to be significantly lower in the PTK7 knockdown group compared to control groups ( ∗ P < 0.05). (c, d) Western blot assay showed that the Ki67 and PCNA proteins were significantly downregulated in the PTK7 knockdown group compared to the control ( ∗ P < 0.05).

Journal: Disease Markers

Article Title: The Increased PTK7 Expression Is a Malignant Factor in Cervical Cancer

doi: 10.1155/2019/5380197

Figure Lengend Snippet: PTK7 regulated cell proliferation by Ki67 and PCNA proteins. (a) Colony formation assay. Results demonstrated that in Caski and SiHa cell lines, the control groups showed significantly higher survival fraction than the PTK7 knockdown groups ( ∗ P < 0.05). (b) MTT proliferation assay. OD values were showed to be significantly lower in the PTK7 knockdown group compared to control groups ( ∗ P < 0.05). (c, d) Western blot assay showed that the Ki67 and PCNA proteins were significantly downregulated in the PTK7 knockdown group compared to the control ( ∗ P < 0.05).

Article Snippet: Human predesigned targeted short hairpin RNA (shRNA) recombinant virus against PTK7 was purchased from Vigene (target sequence: AACATCAAATGGATTGAGGCAGG; Vigene Biosciences Inc.).

Techniques: Colony Assay, Control, Knockdown, Proliferation Assay, Western Blot

The role of PTK7 in cell migration and invasion in cervical cancer. (a) Cell scratch assay. The PTK7 knockdown group showed to have a great scratch gap in both two cervical cancer cell lines than control groups, respectively ( ∗ P < 0.05). (b) Cell invasion assay. The number of invasive cells in PTK7 knockdown groups was significantly lower than the control groups ( ∗ P < 0.05). (c, d) Western blot assay showed that MMP2 and MMP9 proteins were significantly downregulated in the PTK7 knockdown group compared to the control ( ∗ P < 0.05).

Journal: Disease Markers

Article Title: The Increased PTK7 Expression Is a Malignant Factor in Cervical Cancer

doi: 10.1155/2019/5380197

Figure Lengend Snippet: The role of PTK7 in cell migration and invasion in cervical cancer. (a) Cell scratch assay. The PTK7 knockdown group showed to have a great scratch gap in both two cervical cancer cell lines than control groups, respectively ( ∗ P < 0.05). (b) Cell invasion assay. The number of invasive cells in PTK7 knockdown groups was significantly lower than the control groups ( ∗ P < 0.05). (c, d) Western blot assay showed that MMP2 and MMP9 proteins were significantly downregulated in the PTK7 knockdown group compared to the control ( ∗ P < 0.05).

Article Snippet: Human predesigned targeted short hairpin RNA (shRNA) recombinant virus against PTK7 was purchased from Vigene (target sequence: AACATCAAATGGATTGAGGCAGG; Vigene Biosciences Inc.).

Techniques: Migration, Wound Healing Assay, Knockdown, Control, Invasion Assay, Western Blot

PTK7-depleted cells inhibit cervical cancer growth in vivo. (a, b) Xenograft assay. The tumor volume of the PTK7 knockdown group was significantly smaller than that of the control, after 4 weeks of management ( ∗ P < 0.05). (c, d) PTK7 protein level was dramatically decreased in the PTK7 knockdown group of injected tumor xenografts in nude mice by IHC and Western blot assays ( ∗ P < 0.05).

Journal: Disease Markers

Article Title: The Increased PTK7 Expression Is a Malignant Factor in Cervical Cancer

doi: 10.1155/2019/5380197

Figure Lengend Snippet: PTK7-depleted cells inhibit cervical cancer growth in vivo. (a, b) Xenograft assay. The tumor volume of the PTK7 knockdown group was significantly smaller than that of the control, after 4 weeks of management ( ∗ P < 0.05). (c, d) PTK7 protein level was dramatically decreased in the PTK7 knockdown group of injected tumor xenografts in nude mice by IHC and Western blot assays ( ∗ P < 0.05).

Article Snippet: Human predesigned targeted short hairpin RNA (shRNA) recombinant virus against PTK7 was purchased from Vigene (target sequence: AACATCAAATGGATTGAGGCAGG; Vigene Biosciences Inc.).

Techniques: In Vivo, Xenograft Assay, Knockdown, Control, Injection, Western Blot

Tm4f4 disrupts actin organization and migration through a ROCK-independent Rho GTPase pathway. (A-I) F-actin localization and organization was analyzed by rhodamine phalloidin staining in NIH 3T3 fibroblast (A) and 293T fibroblast (B,C) cells expressing (arrows) or not expressing (arrowheads) Tm4sf4-FLAG, as well as in mPacL20 ductal epithelial cells transfected with control siRNA (D-F) or siTm4sf4 (G-I). Confocal magnification 63×. (J) Schematic depicting cytoskeletal actin structures (yellow) affected by Tm4sf4. (K) Percentage of mPacL20 cells exhibiting the phenotype displayed in G-I. (L,M) Nuclei positive cells migrated in Boyden chamber assays were compared in siControl (gray) and siTm4sf4 (black) transfected cells 16 hours after cells were treated with Rho family GTPase modulators. Error bars represent s.e.m. *P<0.05, **P<0.01.

Journal: Development (Cambridge, England)

Article Title: The L6 domain tetraspanin Tm4sf4 regulates endocrine pancreas differentiation and directed cell migration

doi: 10.1242/dev.058693

Figure Lengend Snippet: Tm4f4 disrupts actin organization and migration through a ROCK-independent Rho GTPase pathway. (A-I) F-actin localization and organization was analyzed by rhodamine phalloidin staining in NIH 3T3 fibroblast (A) and 293T fibroblast (B,C) cells expressing (arrows) or not expressing (arrowheads) Tm4sf4-FLAG, as well as in mPacL20 ductal epithelial cells transfected with control siRNA (D-F) or siTm4sf4 (G-I). Confocal magnification 63×. (J) Schematic depicting cytoskeletal actin structures (yellow) affected by Tm4sf4. (K) Percentage of mPacL20 cells exhibiting the phenotype displayed in G-I. (L,M) Nuclei positive cells migrated in Boyden chamber assays were compared in siControl (gray) and siTm4sf4 (black) transfected cells 16 hours after cells were treated with Rho family GTPase modulators. Error bars represent s.e.m. *P<0.05, **P<0.01.

Article Snippet: For siRNA knockdown, mPacL20 cells were transfected with 10 pmol predesigned siControl (scrambled siRNA not known to degrade any RNA) or siTm4sf4 (sc-154303, Santa Cruz Biotechnology, CA, USA) and 1 μl lipofectamine 2000.

Techniques: Migration, Staining, Expressing, Transfection, Control